Sequences indicating Predicted Off-Targets


Sequence: CG10318_650


The following are potential primary targets:
NC2alpha:covers 650 bp out of 650 bp
There are 4 potential secondary targets.
They are:
22 bptnc
19 bpsec71
19 bpCG12946
19 bpCG2750

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
CATCAAGAAGATCATGCAAAGCGACGAGGAAATCGGGAAGGTGGCCCAGGCGGTGCCTGTTATCATCTCACGCACGCTGG
AGCTCTTCGTGGAGTCGCTGCTGACCAAGACGCTGCGCATCACGAATGCGCGCAACGCCAAGACGCTATCGCCATCGCAC
ATGAGGCAGTGTATCGTATCCGAGAAACGCTTTGACTTCCTCAAGGAGCTGGTCCGCAACATACCCGACATCAGTGTGGC
CGAGGAGGCCGCCTACAACGAGGACGATGTGTTACGCAGCTCGCCAGAGGAACAGTATCCAGATTCAGACACGCCATATG
ATCTTAGCCTGCCATCGACGTCAATGCGCTCGCAGGCGAACGGCACAGCTGCCTACATGCGCTCCATGAGTCTGAACAAC
GGAGCCGGATCGGGCGGAGGAGCCGCAGCCACCAAGCGGCAGTTTCAGTCGCAGCACTCCACCCAGGAAACTCCCACCAC
CAGCACCACCCTGCCCGCCAAGCTGGCCCGCTCCGGGTCCATGCCGGCCTACACGCCACGGGGCAGACCGCCCAATCACC
TCAAGAAACAGTCGGTGCAGCTCGATACTGCCATACCCGCCCCGATCTGCAACTACGAACTCAACAAGCCCATTGTCAAG
ATCGACTACA

Click here for sequence text for cutting and pasting or saving

>CG10318_650 region 1
CATCAAGAAGATCATGCAAAGCGACGAGGAAATCGGGAAGGTGGCCCAGGCGGTGCCTGTTATCATCTCACGCACGCTGG
AGCTCTTCGTGGAGTC

>CG10318_650 region 2
CGCATCACGAATGCGCGCAACGCCAAGACGCTATCGCCATCGCACATGAGGCAGTGTATCGTATCCGAGAAACGCTTTGA
CTTCCTCAAGGAGCTGGTCCGCAACATACCCGACATCAGTGTGGCCGAGGAGGCCGCCTACAACGAGGACGATGTGTTAC
GCAGCTCGCCAGAGGAACAGTATCCAGATTCAGACACGCCATA

>CG10318_650 region 3
ACGTCAATGCGCTCGCAGGCGAACGGCACAGCTGCCTACATGCGCTCCATGAGTCTGAACAACGGAGCCGGATCGGG

>CG10318_650 region 4
AAGCGGCAGTTTCAGTCGCAGCACTCCACCCAGGAAACTC

>CG10318_650 region 5
CGCCAAGCTGGCCCGCTCCGGGTCCATGCCGGCCTACACGCCACGGGGCAGACCGCCCAATCACCTCAAGAAACAGTCGG
TGCAGCTCGATACTGCCATACCCGCCCCGATCTGCAACTACGAACTCAACAAGCCCATTGTCAAGATCGACTACA