Sequences indicating Predicted Off-Targets


Sequence: CG1046_711


The following are potential primary targets:
zen:covers 711 bp out of 711 bp
There are 10 potential secondary targets.
They are:
27 bpDr
23 bpexex
23 bpind
23 bpHmx
21 bpCG15696
21 bpbap
20 bpcad
20 bpScr
20 bpDll
20 bpUbx

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
AACTTGAGAACGAGTTCAAGAGCAACATGTACTTGTACAGGACGCGCAGGATTGAGATTGCTCAGCGCTTGTCCCTGTGC
GAACGCCAGGTGAAGATCTGGTTCCAGAACCGACGAATGAAGTTCAAGAAGGACATACAAGGTCACCGCGAGCCCAAGTC
CAACGCCAAGTTGGCTCAACCCCAGGCTGAGCAGAGTGCCCACCGAGGCATAGTGAAGCGCCTCATGTCCTACTCCCAGG
ATCCCAGGGAGGGCACAGCGGCAGCAGAAAAGCGTCCTATGATGGCAGTGGCTCCTGTGAATCCAAAGCCAGACTATCAA
GCCAGCCAGAAAATGAAGACCGAAGCATCAACCAACAACGGCATGTGCTCCAGCGCCGACCTCAGCGAGATCTTGGAGCA
TCTGGCTCAAACTACAGCTGCACCACAGGTCAGCACTGCCACATCTAGCACAGGAACATCTACCAACTCGGCTTCTAGCT
CCTCTTCGGGCCACTATTCCTACAACGTGGATTTGGTTCTGCAGAGCATCAAGCAGGATTTGGAGGCAGCGGCCCAGGCT
TGGTCCAAGTCTAAATCCGCGCCTATCCTGGCCACTCAATCCTGGCATCCCAGTTCCCAAAGTCAGGTCCCCACGAGCGT
GCATGCGGCTCCCTCGATGAATCTGTCGTGGGGCGAGCCTGCTGCCAAGTCGAGAAAGCTGAGCGTTAATC

Click here for sequence text for cutting and pasting or saving

>CG1046_711 region 1
AACTTGAGAACGAGTTCAAGAGCAACATGTACTTGTACAGGACGCGCAGGATTGAGATTGCTCAGCGCTTGTCCCTGTGC
GAACG

>CG1046_711 region 2
AATGAAGTTCAAGAAGGACATACAAGGTCACCGCGAGCCCAAGTCCAACGCCAAGTTGGCTCAACCCCAGGCTGAGCAGA
GTGCCCACCGAGGCATAGTGAAGCGCCTCATGTCCTACTCCCAGGATCCCAGGGAGGGCACAGCGGCAGCAGAAAAGCGT
CCTATGATGGCAGTGGCTCCTGTGAATCCAAAGCCAGACTATCAAGCCAGCCAGAAAATGAAGACCGAAGCATCAACCAA
CAACGGCATGTGCTCCAGCGCCGACCTCAGCGAGATCTTGGAGCATCTGGCTCAAACTACAGCTGCACCACAGGTCAGCA
CTGCCACATCTAGCACAGGAACATCTACCAACTCGGCTTCTAGCTCCTCTTCGGGCCACTATTCCTACAACGTGGATTTG
GTTCTGCAGAGCATCAAGCAGGATTTGGAGGCAGCGGCCCAGGCTTGGTCCAAGTCTAAATCCGCGCCTATCCTGGCCAC
TCAATCCTGGCATCCCAGTTCCCAAAGTCAGGTCCCCACGAGCGTGCATGCGGCTCCCTCGATGAATCTGTCGTGGGGCG
AGCCTGCTGCCAAGTCGAGAAAGCTGAGCGTTAATC