Sequences indicating Predicted Off-Targets


Sequence: CG1066_644


The following are potential primary targets:
Shab:covers 644 bp out of 644 bp
There is 1 potential secondary target.
It is:
19 bpCG14223

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
ACTCGATTCCCACAACCTCCCAGCAGATCGTTGGCAGCGTCGGTGGCGTGGGCGTCGGTGGTGCCAGCAGCCAGTCGATT
TCGGGCGGTGTTCCCACCCACAGCCAGAGCAACACCACCGGCGCTCTGCAGCGGACACATTCCAGATCCATGTCCTCCAT
ACCGCCGCCCGAGCCGTTCATGATAGCCCAGTCGAAGGCGGTCAACAGCCGCGTGTCCATCAACGTGGGCGGGGTGAGGC
ACGAGGTCCTGTGGAGGACGCTGGAGCGGCTGCCCCACACGCGGCTCGGGCGGCTGAGGGAGTGCACCACCCACGAGGCC
ATCGTGGAGCTGTGCGACGACTACTCGCTGGCGGACAACGAGTACTTCTTCGACCGACATCCGAAGAGCTTCAGCTCCAT
CCTGAACTTCTATCGCACCGGCAAGCTGCACATCGTCGACGAGATGTGCGTGCTCGCGTTTAGTGATGACCTGGAGTACT
GGGGCGTCGACGAACTGTACCTGGAGTCCTGCTGCCAGCACAAGTACCACCAGCGCAAGGAGAACGTTCACGAGGAGATG
CGTAAGGAGGCCGAGTCCCTGCGGCAGCGCGACGAGGAGGAATTCGGCGAAGGTAAATGCGCCGAGTACCAGAAGTATCT
GTGG

Click here for sequence text for cutting and pasting or saving

>CG1066_644 region 1
ACTCGATTCCCACAACCTCCCAGCAGATCGTTGGCAGCGTCGGT

>CG1066_644 region 2
CCAGCAGCCAGTCGATTTCGGGCGGTGTTCCCACCCACAGCCAGAGCAACACCACCGGCGCTCTGCAGCGGACACATTCC
AGATCCATGTCCTCCATACCGCCGCCCGAGCCGTTCATGATAGCCCAGTCGAAGGCGGTCAACAGCCGCGTGTCCATCAA
CGTGGGCGGGGTGAGGCACGAGGTCCTGTGGAGGACGCTGGAGCGGCTGCCCCACACGCGGCTCGGGCGGCTGAGGGAGT
GCACCACCCACGAGGCCATCGTGGAGCTGTGCGACGACTACTCGCTGGCGGACAACGAGTACTTCTTCGACCGACATCCG
AAGAGCTTCAGCTCCATCCTGAACTTCTATCGCACCGGCAAGCTGCACATCGTCGACGAGATGTGCGTGCTCGCGTTTAG
TGATGACCTGGAGTACTGGGGCGTCGACGAACTGTACCTGGAGTCCTGCTGCCAGCACAAGTACCACCAGCGCAAGGAGA
ACGTTCACGAGGAGATGCGTAAGGAGGCCGAGTCCCTGCGGCAGCGCGACGAGGAGGAATTCGGCGAAGGTAAATGCGCC
GAGTACCAGAAGTATCTGTGG