Sequences indicating Predicted Off-Targets


Sequence: CG11061_633


The following are potential primary targets:
GM130:covers 633 bp out of 633 bp
There are 4 potential secondary targets.
They are:
20 bpCG9486
20 bpCG14562
19 bpFas1
19 bpCG7197

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
TGGTCTTTTGCATAATCATTCGCACGATCACTCTCATCAGCATTCCGACGGTCATTGTCATGATAATGACCACGATCATT
CCCATGAACATAACCATCATAATGCTGGTGATCATGGTCATCCACATGATCATCCGCACGATCACACACATGATCATTCA
CATAGCCATCCACACGATCATCAGCATGATCATCCACATGATCACGGCCAGAACCACGCCCACAGACAAGCAGCTGAAAC
GCTGCCCACCGCCGAGGCCGTGGAACGCTTGCAATCGCGTTTCACCACACTGATCAGCCAGGTCGCCGACTTGACGGAGG
AGAAGCACAGCCTGGAGCATCTGGTGCTCCAGCTGCAGAGCGAAACCGAAACGATTGGCGAGTACATTGCCCTCTATCAA
ACGCAGAGGCGCATGCTAAAGCAGCGTGAGTACGAGAAGGCCGCCCAAATGCGTCTCTTGCAAGCGGAGCGAGAGCAGCT
GCGCGAGAAGATTGAGGCACTAAACAAGCTGGTGGTCAGTTTGGGCGTGGAGCTACCCGCAGATGCCGCCCAGGCAAAGC
AACCAGAAGCGGCCGCAGGTAGCGAACACACTCCTGGCGAAGGTGAAAACTCGCAACAGATCATCAACAAGAT

Click here for sequence text for cutting and pasting or saving

>CG11061_633 region 1
TGGTCTTTTGCATAATCATTCGCACGATCACTCTCATCAGCATTCCGACGGTCATTGTCATGATAATGACCACGATCATT
CCCATGAACATAACCATCATAAT

>CG11061_633 region 2
CACATGATCATCCGCACGATCACACACATGATCATTCACATAGCCATCCACACGATCATCAGCATGATCATCCACATGAT
CA

>CG11061_633 region 3
GACAAGCAGCTGAAACGCTGCCCACCGCCGAGGCCGTGGAACGCTTGCAATCGCGTTTCACCACACTGATCAGCCAGGTC
GCCGACTTGACGGAGGAGAAGCACAGCCTGGAGCATCTGGTGCTCCAGCTGCAGAGCGAAACCGAAACGATTGGCGAGTA
CATTGCCCTCTATCAAACGCAGAGGCGCATGCTAAAGCAGCGTGAGTACGAGAAGGCCGCCCAAATGCGTCTCTTGCA

>CG11061_633 region 4
GCGAGAAGATTGAGGCACTAAACAAGCTGGTGGTCAGTTTGGGCGTGGAGCTACCCGCAGATGCCGCCCAGGCAAAGCAA
CCAGAAGCGGCCGCAGGTAGCGAACACACTCCTGGCGAAGGTGAAAACTCGCAACAGATCATCAACAAGAT