Sequences indicating Predicted Off-Targets


Sequence: CG11099_611


The following are potential primary targets:
CG11099:covers 611 bp out of 611 bp
There are 0 potential secondary targets.

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
TCAGTGAAAGGTGCTATGATGGGCGATTTGTTATTGCAACAATAAATAAGTAAGAAGAAAATAAAATTCGAAGGCGGTGC
TCGCGAGAAATTGCGACAGGCGGCCAGTGAGACAAATTTAGCCGAGATAGATAGAGATTCTTGGTGGAGAGCAAACTGTT
GCTGCTGATTCTAGTGGTGCTGCCACTGGGCCTGAGCCACTGGGTGGCTGTGGTGGCGCTGGTGGCGGTGGCAGTTTTTG
TTTGGCGGGCGGCGGTGCCAAATGATGATCATGACCGCGTAGAGACGCAAATAAATATAATTGAAACACGATCAAACTAT
AAGCAAATACGCCAATTGTGTAACTGCAACGGTATCGTCAAAATGAACAAAACGATTCTGCACTGGAGCTACCTGAATTT
CAAGGATGTCCCGATGGATCTGTTCCTCTACGAGGATCTCGAGGAAGTCTACCTCAAGGAGAACTTCATCTCGGTGATAC
CCAAATGGCTGCTGAACATCACCACACTGAAGTTTATTCATTTGGCTGGCAATAATCTGAGTGAACTGCCGGTGGACATC
TATATGCTGGAGAATCTGGAGTTCCTGGACGTATCCAACAATGAGCTCAAG

Click here for sequence text for cutting and pasting or saving

>CG11099_611 region 1
TCAGTGAAAGGTGCTATGATGGGCGATTTGTTATTGCAACAATAAATAAGTAAGAAGAAAATAAAATTCGAAGGCGGTGC
TCGCGAGAAATTGCGACAGGCGGCCAGTGAGACAAATTTAGCCGAGATAGATAGAGATTCTTGGTGGAGAGCAAACTGTT
GCTGCTGATTCTAGTGGTGCTGCCACTGGGCCTGAGCCACTGGGTGGCTGTGGTGGCGCTGGTGGCGGTGGCAGTTTTTG
TTTGGCGGGCGGCGGTGCCAAATGATGATCATGACCGCGTAGAGACGCAAATAAATATAATTGAAACACGATCAAACTAT
AAGCAAATACGCCAATTGTGTAACTGCAACGGTATCGTCAAAATGAACAAAACGATTCTGCACTGGAGCTACCTGAATTT
CAAGGATGTCCCGATGGATCTGTTCCTCTACGAGGATCTCGAGGAAGTCTACCTCAAGGAGAACTTCATCTCGGTGATAC
CCAAATGGCTGCTGAACATCACCACACTGAAGTTTATTCATTTGGCTGGCAATAATCTGAGTGAACTGCCGGTGGACATC
TATATGCTGGAGAATCTGGAGTTCCTGGACGTATCCAACAATGAGCTCAAG