Sequences indicating Predicted Off-Targets


Sequence: CG11121_648


The following are potential primary targets:
so:covers 648 bp out of 648 bp
There are 33 potential secondary targets.
They are:
21 bpAck
21 bpCG3754
20 bpCHES-1-like
20 bpCG15765
20 bpCG12071
20 bpBtbVII
20 bpCG13921
20 bpCG11462
20 bpl(2)k09913
20 bpX11Lbeta
19 bpCG14304
19 bpEip93F
19 bpmsopa
19 bpbun
19 bpCG18375
19 bpSocs36E
19 bpCG15322
19 bpCG14073
19 bpCG17265
19 bpCG32389
19 bpCG32169
19 bpCG14440
19 bpovo
19 bpHmx
19 bpretn
19 bpCG17742
19 bpSamuel
19 bpCG14442
19 bpCG32778
19 bpCG13739
19 bpvvl
19 bpCG4136
19 bpCG31741

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
TTATGATTCTAGTTGGAGGCGGCCGCTGCCGCCGGTGGCACTGGCGGGGTCAGCGGCGGGGTCAGTGGCGGCAGCAGCAG
CAGCTTGAGCGGCAGCAACATCGCCTTGCAGCAGCGACAACGCCACCAGCAGCAGCAGCAGTGCGAGAGCTTCTACTTCT
GAGGTGGTGGTTGGCCACCAAGCAATATCGCCGGACTCCTTCGGCACAGCAGCACAAACTTTACATATCGCCCGATTGCT
GGAAGGCTGTCATGAGTGGATATTCAGCTTCCAAATGCTTGGCAAGGGGATTCTGGCTGGCGATCCGATGGAGAACTACA
TGGCCCGGGAAACCATATCAAACCGCAGTGGCAATTGGGTCAGCCAACCCAGAAATTCAAGTATCGGCCATGACAGTATT
TTAGCCAATTGCCGATATGCCATTATAGCCCCACACTTTCCGGATAACATGGCATTTCCGCAACCAGAGATAGAGATATA
TAGAATTGGAGCTGCAGCACAATCTCCTGGAAGGATTCCAGGGGGAAACTATGAACTTTCAACTATGACTTCTGCATCGA
TCTGTGTAAATAGCTAGGCTTTAGTTTTTAGTGCGGTTGGGAGGCCGACCGAAATGCAAATCAAATCGAAACGTGCAAAA
ATTAAATG

Click here for sequence text for cutting and pasting or saving

>CG11121_648 region 1
TTATGATTCTAGTTGGAGGCGGCCGCTGCCGCCGGTGGCACTGGCGGGGTCAGCGGCGGGGTC

>CG11121_648 region 2
TTGAGCGGCAGCAACATCGCCTTGCAGCAGCGACAA

>CG11121_648 region 3
GCGAGAGCTTCTACTTCTGAGGTGGTGGTTGGCCACCAAGCAATATCGCCGGACTCCTTCGGCACAGCAGCACAAACTTT
ACATATCGCCCGATTGCTGGAAGGCTGTCATGAGTGGATATTCAGCTTCCAAATGCTTGGCAAGGGGATTCTGGCTGGCG
ATCCGATGGAGAACTACATGGCCCGGGAAACCATATCAAACCGCAGTGGCAATTGGGTCAGCCAACCCAGAAATTCAAGT
ATCGGCCATGACAGTATTTTAGCCAATTGCCGATATGCCA

>CG11121_648 region 4
GGATAACATGGCATTTCCGCAACCAGAGATAGAGATATATAGAATTGGAGCTGCAGCACAATCTCCTGGAAGGATTCCAG
GGGGAAACTATGAACTTTCAACTATGACTTCTGCATCGATCTGTGTAAATAGCTAGGCTTTAGTTTTTAGTGCGGTTGGG
AGGCCGACCGAAATGCAAATCAAATCGAAACGTGCAAAAATTAAATG