Sequences indicating Predicted Off-Targets


Sequence: CG11765_326


The following are potential primary targets:
Prx2540-2:covers 326 bp out of 326 bp
CG12896:covers 308 bp out of 326 bp
Prx2540-1:covers 308 bp out of 326 bp
There are 2 potential secondary targets.
They are:
19 bpCG17780
19 bpCG17781

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
GACTTTACTCCCGTCTGCACCACTGAGCTGGGCAGGATTGCGGTGCACCAGCCGGAGTTTGCCAAGCGGAACACCAAGTG
CCTGGCACATTCCGTTGACGCATTGAACTCGCACGTGGACTGGGTGAACGACATCAAGAGCTATTGCCTGGACATTCCCG
GGGACTTCCCCTACCCGATCATCGCCGACCCTACTCGCGACCTGGCCGTCAGCCTGGGCATGCTCGACGAGGAGCAGAAG
AAGGATCCCGAGGTGGGCAAGACCATCCGCGCCCTGTTCATCATCAGTCCGGACCATAAGGTGCGCCTCTCCATGTTCTA
CCCCAT

Click here for sequence text for cutting and pasting or saving

>CG11765_326 region 1
GACTTTACTCCCGTCTGCACCACTGAGCTGGGCAGGATTGCGGTGCACCAGCCGGAGTTTGCCAAGCGGAACACCAAGTG
CCTGGCACATTCCGTTGACGCATTGAACTCGCACGTGGACTGGGTGAACGACATCAAGAGCTATTGCCTGGACATTCCCG
GGGACTTCCCCTACCCGATCATCGCCGACCCTACTCGCGACCTGGCCGTCAGCCTGGGCATGCTCGA

>CG11765_326 region 2
CCCGAGGTGGGCAAGACCATCCGCGCCCTGTTCATCATCAGTCCGGACCATAAGGTGCGCCTCTCCATGTTCTACCCCAT