Sequences indicating Predicted Off-Targets


Sequence: CG11913_746


The following are potential primary targets:
CG11913:covers 746 bp out of 746 bp
There is 1 potential secondary target.
It is:
19 bpCG32000

The following is a color-coded map to indicate where targets lie: Black indicates target-free regions. Blue indicates primary target regions. Red indicates secondary target (Off-Target) regions or regions that are both secondary and primary target.
GTACATACGCACCATGTTTTCGGAGATAATGAGGCTGACGAATCACACGATGGCCATTGGTTCGTCGGTACTGGACTGTG
GAGCTATAACTCCACTCTTTTGGCTGTTCGAGGAACGTGAGAAGTTGTATGAGTTTTCGGAACGCGCTTCGGGAGCTCGT
CTCCATGCCGCCTACATTCGACCGGGGGGCGTGGCCAGTGATATACCTCTAGGGTTTCTCCACGATTTGTATCAGTTTAT
CAATCAATTCAACGAACGATTGGACGAAGTGGAGGACGTAGTGACCGATAATCGCATCTGGCGTATGCGTAATATTGGCA
TTGGAGTCATATCCGCACACGATGCCTTAAACTATGGATGCACTGGACCCGTTCTGAGGGCCACCGGCGTAAAGTGGGAT
TTGCGTAAGCAACAGCCATACGATGCCTATGACGAGATGGATTTTGACGTGGTTGTGGGATCGAATGGAGACTGCTACGA
TCGCTACTTGGTGCGCATGCGAGAAATGCGCGAGTCGGTGAATATCATCAAGCAATGCATCGACGCCATGCCACCGGGTG
AGATCAAGGTGGATGATCTGAAGATCTGCCCTCCGCAACGAAGCAAGATGAAGGAGGGCATGGAGGATCTGATCCATCAT
TTCAAGCACTTCTCGCAAGGATTCCGGGTGCCTCCGGGACAGACGTACTGTGCCGTTGAATCGCCCAAGGGTGAATTCGG
AGCATTCCTCATCTCCGATGGTTCAT

Click here for sequence text for cutting and pasting or saving

>CG11913_746 region 1
GCTGACGAATCACACGATGGCCATTGGTTCGTCGGTACTGGACTGTGGAGCTATAACTCCACTCTTTTGGCTGTTCGAGG
AACGTGAGAAGTTGTATGAGTTTTCGGAACGCGCTTCGGGAGCTCGTCTCCATGCCGCCTACATTCGACCGGGGGGCGTG
GCCAGTGATATACCTCTAGGGTTTCTCCACGATTTGTATCAGTTTATCAATCAATTCAACGAACGATTGGACGAAGTGGA
GGACGTAGTGACCGATAATCGCATCTGGCGTATGCGTAATATTGGCATTGGAGTCATATCCGCACACGATGCCTTAAACT
ATGGATGCACTGGACCCGTTCTGAGGGCCACCGGCGTAAAGTGGGATTTGCGTAAGCAACAGCCATACGATGCCTATGAC
GAGATGGATTTTGACGTGGTTGTGGGATCGAATGGAGACTGCTACGATCGCTACTTGGTGCGCATGCGAGAAATGCGCGA
GTCGGTGAATATCATCAAGCAATGCATCGACGCCATGCCACCGGGTGAGATCAAGGTGGATGATCTGAAGATCTGCCCTC
CGCAACGAAGCAAGATGAAGGAGGGCATGGAGGATCTGATCCATCATTTCAAGCACTTCTCGCAAGGATTCCGGGTGCCT
CCGGGACAGACGTACTGTGCCGTTGAATCGCCCAAGGGTGAATTCGGAGCATTCCTCATCTCCGATGGTTCAT